View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_105 (Length: 290)
Name: NF11278_low_105
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_105 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 19 - 285
Target Start/End: Complemental strand, 20874 - 20608
Alignment:
| Q |
19 |
caacctccccataagattgatgaaaacatgtggaagaatcgagaatatattgaagaaaccannnnnnnacttcaacaatctaattggccagacccggtaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20874 |
caacctccccataagattgatgaaaacatgtggaagaatcgagaatatattgaagaaaccatttttttacttcaacaatctaattggccagacccggtaa |
20775 |
T |
 |
| Q |
119 |
tgtaatccagatccattttccccttttcattcggtctctttaacataacattcttattgagatttgatttgatttcgatgatgcagctgaaacaacagca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20774 |
tgtaatccagatccattttccccttttcactcggtctctttaacataacattcttattgagatttgatttgatttcgatgatgcagctgaaacaacagca |
20675 |
T |
 |
| Q |
219 |
gtccacacctgacaatattcaattttccattattcttgggaagctcaaagataaacttcatctcact |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20674 |
gtccacacctgacaatattcaattttccattattcttgggaagctcaaagataaacttcatcgcact |
20608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University