View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_109 (Length: 283)
Name: NF11278_low_109
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_109 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 11 - 283
Target Start/End: Original strand, 41065827 - 41066099
Alignment:
| Q |
11 |
cacagacagtgtttgtggatcttgaccgaaagccaagccacatatgttgtcgaaagtgaggcgtaggagaaggtcttgaagatcaaccgggnnnnnnnct |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41065827 |
cacagacagtgtttgtggatcttgaccgaaagccaagccacatatgttgtcgaaagtgaggcgtaggagaaggtcttgaagatcaaccgggtttttttct |
41065926 |
T |
 |
| Q |
111 |
tcttgtgccgtcgctaatattggacagaatctatactttatggctcggctaacccatcgagccatggcttgtcgtagggtacgagtggtgaactctagtg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41065927 |
tcttgtgccgtcgctaaaattggacagaatctatactttatggctcggctaacccatcgagccatggcttgtcgtagggtacgagtggtgaactctagtg |
41066026 |
T |
 |
| Q |
211 |
cggcgggttttcgctgggacagccccaagtcaccctctgagttaaatataccttctcccaggaaatcatgaaa |
283 |
Q |
| |
|
| |||| ||| |||||| |||||| || |||||| ||||||||||||||||||||||| || || |||||||| |
|
|
| T |
41066027 |
ctgcggttttacgctggaacagccacatgtcaccatctgagttaaatataccttctccgagtaagtcatgaaa |
41066099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 150 - 202
Target Start/End: Complemental strand, 11314693 - 11314641
Alignment:
| Q |
150 |
atggctcggctaacccatcgagccatggcttgtcgtagggtacgagtggtgaa |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||| || | ||||| |||||||| |
|
|
| T |
11314693 |
atggctcggctaacccatctagccatggcttggcgcaaagtacgcgtggtgaa |
11314641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University