View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_114 (Length: 272)
Name: NF11278_low_114
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_114 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 4817653 - 4817398
Alignment:
| Q |
1 |
caagggggattgtagactttgccattgttcttgatattgttggtatgaatatatgaaaattaatttactttaattaaaggtgatggtgtgtttgcaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4817653 |
caagggggattgtagactttgccattgttcttgatattgttggtatgagtatatgaaaattaatttactttaattaaaggtgatggtgtgtttgcaatga |
4817554 |
T |
 |
| Q |
101 |
agaagggcttgcattttatactaaaataaataatggatcaaactagtttctgtttattttttctgtttgttctttgaggttctaatgtctcccattattt |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4817553 |
agaaggacttgcattttatactaaaataaataatggatcaaactagtttctgtttattttttctgtttgttctttgaggttctaatgtctcccattattt |
4817454 |
T |
 |
| Q |
201 |
gtggatggtcgaaatttttgttttgacccgttttttcctctcctagtttgaaattg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4817453 |
gtggatggtcgaaatttttgttttgacccgttttttcctctcctagtttgaaattg |
4817398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University