View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_117 (Length: 262)
Name: NF11278_low_117
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_117 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 1560822 - 1561039
Alignment:
| Q |
18 |
cacagagcaaagatgaacaaccaacaagatatgtggcacatgaacacacaaactaaaggtgaacatccaacatggtccatgacacaaacctcccaagcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1560822 |
cacagagcaaagatgaacaaccaacaagttatgtgccacatgaacacacagactaaaggtgaacatccaacatggtccatgacacaaaccttccaagcac |
1560921 |
T |
 |
| Q |
118 |
agatggacgattgagaagtagaagccaaaccatacaaacacaatcgggccccaaaacccacaccatcaaactcgatcaataccagcacatgagcagatgc |
217 |
Q |
| |
|
| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
1560922 |
aaatggacgactgagaagtagaagccaaaccatacaaacacaatcgggccccaaagcccacaccatcaaactcgat------cagcacatgagtagatgc |
1561015 |
T |
 |
| Q |
218 |
taccaaggttttttaccaaggaac |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1561016 |
taccaaggttttttaccaaggaac |
1561039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University