View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_119 (Length: 260)
Name: NF11278_low_119
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_119 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 235
Target Start/End: Original strand, 43362726 - 43362944
Alignment:
| Q |
17 |
cagagagcacaaacaaaaacaaatgtcattaaatcactttatacttcaacaagaacagcgtaatatagcaatgtaatacaagaacataattaaacacaac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43362726 |
cagagagcacaaacaaaaacaaatgtcattaaatcactttatacttcaacaagaacagcataatatagcaatgtaatacaagaacataattaaacacaac |
43362825 |
T |
 |
| Q |
117 |
aatttaacaagattatagatcaatcaaaatatattctttatcagaactatccatgcatttcttcaaaatgagctaattcatcaatcttctaaaaacgagt |
216 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43362826 |
aatgtaacaagattatagatcaatcaaaatatattctttatcagaactatccatgcatttcttcaaaatgagctaattcatcaatcttctaaaaacgagt |
43362925 |
T |
 |
| Q |
217 |
caatgcaatgtttgtcatt |
235 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
43362926 |
caatgcaatgtatgtcatt |
43362944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University