View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_123 (Length: 254)
Name: NF11278_low_123
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_123 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 7325777 - 7325997
Alignment:
| Q |
18 |
tattccattagtgggactagatggaggcaaatgataataccataatggtacaactatagaaaccttataagattgcatgctctaaatgagggcaagaatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7325777 |
tattccattagtgggactagatggaggcaaatggtaacaccataatggtacaattatggaaaccttataaagttgcatgctctaaatgagggcaagaatt |
7325876 |
T |
|
| Q |
118 |
ttctcaagaggacggagaagcacacttc-ggggtagaagaaggtgtggtatctatcttcttgnnnnnnnnnnnnnattaaggtccaaattaattgtcgta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
7325877 |
ttctcaagaggacggagaagcacacttcaggggtagaagacggtgtggtatctatcttctt--------ttttttactaaggtccaaattaattgtcgtt |
7325968 |
T |
|
| Q |
217 |
aaggaaaaataaataaacctatttgtatt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7325969 |
aaggaaaaataaataaacctatttgtatt |
7325997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University