View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_125 (Length: 252)
Name: NF11278_low_125
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_125 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 33195811 - 33195905
Alignment:
| Q |
1 |
tgacaatttttgttcatcgttatttgaaagaagctagaacataaaacaggtgacattgcgattgtaacttctactaataatgcaaataaaatata |
95 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33195811 |
tgacaatttttgttcatcgtgatttgaaagaagctagaacataaaacaggtgacattgcgattgtaacttctactattaatgcaaataaaatata |
33195905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 156 - 235
Target Start/End: Original strand, 33195966 - 33196045
Alignment:
| Q |
156 |
tgattaattggtgacaatgatacacatggaatggcacattgatggctctagcttatcctttttgtattttatgagatata |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33195966 |
tgattaattggtgacaatgatacacatggaatggcacattgatggctctagcttatcctttttgtattttatgagatata |
33196045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University