View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_133 (Length: 250)
Name: NF11278_low_133
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_133 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 17 - 250
Target Start/End: Complemental strand, 41066300 - 41066067
Alignment:
| Q |
17 |
caccatgcaacccgcatgcacgactggatcgctgataatctccgcgcgtgtggcggcacgtaccaaacatgcatctgcgccgttcctttcctcgccagaa |
116 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066300 |
caccatgcaaaccgcatgcacgactggatcgctgataatctccgcgcgtgtggcggcacgtaccaaacatgcatctgcgccgttcctttcctcgccagaa |
41066201 |
T |
 |
| Q |
117 |
aacagtgtctcgtgactgtcacgtgcgatccaaagaacctcgaacacatcctcaaactccggttcgacaattacccaaaaggtccaacatggcagtcagt |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066200 |
aacagtgtctcgtgactgtcacgtgtgatccaaagaacctcgaacacatcctcaaactccggttcgacaattacccaaaaggtccaacatggcagtcagt |
41066101 |
T |
 |
| Q |
217 |
gtttcatgacttactcggagaaggtatatttaac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41066100 |
gtttcatgacttactcggagaaggtatatttaac |
41066067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University