View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_141 (Length: 248)
Name: NF11278_low_141
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_141 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 37366202 - 37365975
Alignment:
| Q |
1 |
gtgaagttatcaggtaaaatgttgtgggttattttcatgaggttgaaaaagtggaaggattgatgaaaaggtgggaatgaagaatgggctttgataatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37366202 |
gtgaagttatcaggtaaaatgttgtgggtcattttcatgaggttgaaaaagtggaaggattgatgaaaaggtgggaatgaagaatgggctttgataatgg |
37366103 |
T |
|
| Q |
101 |
agttgaagaggagaatgttggggtgatgggtatggttgaagatggttgtggcgtaaggaatttggtgaagagaggtgcaaacggagacgaagtgggagag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37366102 |
agttgaagaggagaatgttggggtgatgggtatggttgaagatggttgtggcgtaaggaatttggtgaagagaggtgcaaacggagacgaagtgggagag |
37366003 |
T |
|
| Q |
201 |
gatttggttggaatggtggaggccatgg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37366002 |
gatttggttggaatggtggaggccatgg |
37365975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University