View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_146 (Length: 243)
Name: NF11278_low_146
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_146 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 30183928 - 30183744
Alignment:
| Q |
17 |
acaagttggttccatggtagagtctcttgtacctaaaactgcaaccaagagataagtgaactcaatgacttgttttctgacccacattttccattaatta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30183928 |
acaagttggttccatggtagagtctcttgtacctaaaactgcaaccaagagataagtgaactcaatgacttgttttctgacccacattttccattaatta |
30183829 |
T |
|
| Q |
117 |
aaaagtaatcccagtccgtaactgtcttttgtttgaaattattaattcattacattacattaccaatatatttgctcccttatta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30183828 |
aaaagtaatcccagtccgtaactgtcttttgtttgaaattattaattcattacattacattaccaatatatttgctcccatatta |
30183744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University