View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11278_low_150 (Length: 242)

Name: NF11278_low_150
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11278_low_150
NF11278_low_150
[»] chr4 (1 HSPs)
chr4 (12-220)||(42687074-42687288)


Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 42687074 - 42687288
Alignment:
12 acagaaaagctggagtaatggaagcaacctg------tctaagtaaataagtcagacactgtaacctagactggcagcgagagcacgttattcagcttct 105  Q
    |||||||||||||||||||||||||||||||      |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
42687074 acagaaaagctggagtaatggaagcaacctgaagatctctaagtaaataagtcagacactgtaacctagactggcagcgagagcacgatattcagcttct 42687173  T
106 gttgagcaatgagatacaattgcttgcttctttgaacaccatgaaatgagtgtcacccaagaagacgcagtatcctgtgacagatcttcgagaagtaggg 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
42687174 gttgagcaatgagatacaattgcttgcttctttgaacaccatgaaatgagtgtcacccaagaagatgcagtatcctgtgacagatcttcgagaagtaggg 42687273  T
206 caagtagccctatcg 220  Q
    || ||||||||||||    
42687274 caggtagccctatcg 42687288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University