View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_151 (Length: 241)
Name: NF11278_low_151
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_151 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 25029802 - 25030024
Alignment:
| Q |
1 |
tatgtcccatggctgcagctacggttggatggactttgattctttaaaatttgtggcagcaaaactgacagcccctacattgttctggaaacaaacagaa |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25029802 |
tatgtcccatggttgcagctacggttggatggactttgattctttaaaatttgtggcagcaaaactgacagcccgtacattgttctggaaacaaacagaa |
25029901 |
T |
 |
| Q |
101 |
aacacatatccatttaaattgcaatcagtgtcctccactttgtccagtcgatatcctgcccagcccca-ctagcgctaaccatgacttgctgccctctac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25029902 |
aacacatatccatttaaattgcaatcagtgtcctccactttgtccagtcgatatcctgcccagccccacctagcgctaaccatgacttgctgccctctac |
25030001 |
T |
 |
| Q |
200 |
actctatatcttaaaacaaattt |
222 |
Q |
| |
|
| ||||||||||||||||||||| |
|
|
| T |
25030002 |
attctatatcttaaaacaaattt |
25030024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University