View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_152 (Length: 240)
Name: NF11278_low_152
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_152 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 55 - 212
Target Start/End: Original strand, 30507304 - 30507461
Alignment:
| Q |
55 |
atcataagctcaaactattgtctctataaatagtagatgaacaatatggattgttgcgactcaatttttatatccttgcgattacaaatttcaaatcatt |
154 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30507304 |
atcataagctcaaactattgtctctctaaatagtacatgaacaatatgaattgttgcgcctcaatttttatatccttgcgattacaaatttcaaatcatt |
30507403 |
T |
|
| Q |
155 |
tgcaattggggattctccatattaatgcaattatgacatcagtggtcgtttgatcaag |
212 |
Q |
| |
|
||||||||||||||||| ||||||| ||||| ||||||||||||||| |||||||||| |
|
|
| T |
30507404 |
tgcaattggggattctctatattaacgcaatcatgacatcagtggtcatttgatcaag |
30507461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 30506964 - 30507014
Alignment:
| Q |
1 |
ttaaaatggggcagcaagcccgtgcgtcacgccttggtcatgtacttgcat |
51 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30506964 |
ttaaaacggggcagcaagcccgtgtgtcacgccttggtcatgtacttgcat |
30507014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University