View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_159 (Length: 230)
Name: NF11278_low_159
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_159 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 46 - 150
Target Start/End: Complemental strand, 2230529 - 2230425
Alignment:
| Q |
46 |
agatatatgcagagtggaaagtgaagggaattttcgggctagaggatggcatcgatgagtttgtacgagaaccgagtgaagaaggaccaaaaatatggag |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2230529 |
agatatatgcagagtggaaagtgaagggaattttcgggctagaggatggcatcgatgaatttgtacgagaaccgagtgaagaaggaccaaaaatatggag |
2230430 |
T |
|
| Q |
146 |
atcaa |
150 |
Q |
| |
|
||||| |
|
|
| T |
2230429 |
atcaa |
2230425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 164 - 206
Target Start/End: Complemental strand, 2230408 - 2230366
Alignment:
| Q |
164 |
aaaatagagaaatcaagtgtgcttttgaacctatttttaattt |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
2230408 |
aaaatagagaaatcaagtgtacttttgagcctatttttaattt |
2230366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University