View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_161 (Length: 229)
Name: NF11278_low_161
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_161 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 21 - 229
Target Start/End: Complemental strand, 18701519 - 18701308
Alignment:
| Q |
21 |
gactgatatactagttttaaaatgtttcttttaaaattcaaagattaccacatacttct---gccaatgaagcctctgactgcttcaatcttacattctc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18701519 |
gactgatatactagttttaaaatgtttcttttaaaattcaaagattaccacatacttctcctgccaatgaagcctctgactgcttcaatcttacattctc |
18701420 |
T |
 |
| Q |
118 |
ctcaatctcctctaactgcttttcataacgctctatatgattatttctttgatgaaaaagtcgagaaaaggctccttgcttaatcttctgcttagtggga |
217 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18701419 |
ctcaatctccgctaactgcttttcataacgctctatatgattatttctttggtgaaaaagtcgagaaaaggctccttgcttaatcttctccttagtggga |
18701320 |
T |
 |
| Q |
218 |
tttggtcgtgat |
229 |
Q |
| |
|
| |||||||||| |
|
|
| T |
18701319 |
tctggtcgtgat |
18701308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University