View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_165 (Length: 227)
Name: NF11278_low_165
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_165 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 84 - 210
Target Start/End: Original strand, 48045467 - 48045593
Alignment:
| Q |
84 |
acactacttgcatatttctgtcgggtcttgcttagacaaagtgtcaggtttgtcaattttattacctaaaaccagcaattgaatccaattttaagaaggt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48045467 |
acactacttgcatatttctgtcgggtcttgcttagacaaattgtcaggtttgtcaattttattacctaaaaccagcaattgaatccaattttaagaaggt |
48045566 |
T |
 |
| Q |
184 |
ttgctcaacaaattcatggagttccct |
210 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
48045567 |
ttgctcaacaaagtcatggagttccct |
48045593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 36 - 80
Target Start/End: Original strand, 48044638 - 48044682
Alignment:
| Q |
36 |
tatggattgaatattatagaaccacaaatgcagatatattaatat |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48044638 |
tatggattgaatattatagaaccacaaatgcagagatattaatat |
48044682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 98 - 158
Target Start/End: Original strand, 48056908 - 48056968
Alignment:
| Q |
98 |
tttctgtcgggtcttgcttagacaaagtgtcaggtttgtcaattttattacctaaaaccag |
158 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||| |||||||| | |||||| |
|
|
| T |
48056908 |
tttctgtcgtgtcttgcttagacaaagcaccaggtttgtcaatcttattaccaagaaccag |
48056968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University