View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_170 (Length: 210)
Name: NF11278_low_170
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_170 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 194
Target Start/End: Original strand, 37023256 - 37023434
Alignment:
| Q |
16 |
agatgaaagtggaagagttaagcttggtgggagtatcattgtaccatctgtctatgtgacaggtttgtatcattaactacttaattgcgaaaaattgttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37023256 |
agatgaaagtggaagagttaagcttggtgggagtatcattgtaccatctgtctatgtgacaggtttgtatcattaactacttaattgagaaaaattgttt |
37023355 |
T |
 |
| Q |
116 |
tgtggtggtaggataacatttttgaaaggcacaactgcacattcatttgaagaaactaagtttggtacatgtcatttct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
37023356 |
tgtggtggtaggataacatttttgaaaggcacaactgcacattcattcgaagaaactaagtttggtatatgtcatttct |
37023434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University