View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_47 (Length: 435)
Name: NF11278_low_47
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 3e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 244 - 418
Target Start/End: Original strand, 40809295 - 40809469
Alignment:
| Q |
244 |
aagtactacatgagaatccaaatatattgagtcagtcattagcccacagaattggtatggtatataaaaacaaagaagctagctaacattgttctctttt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809295 |
aagtactacatgagaatccaaatatattgagtcagtcactagcccacagaattggtatggtagataaaaacaaagaagctagctaacattgttctctttt |
40809394 |
T |
|
| Q |
344 |
tatatattttactttttagtttatcttcaagttagtggaaagtccccccacatgatcacttcatagatatctctg |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809395 |
tatatattttactttttagtttatcttcaagttagtggaaagtccccccacatgatcacttcatagatatctctg |
40809469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 17 - 74
Target Start/End: Original strand, 40808915 - 40808972
Alignment:
| Q |
17 |
gaattcatgcacattgaagacaaaaagaaaagataaatttcattgtaagtgatgtaat |
74 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40808915 |
gaattcatacacattgaagacaaaaagaaaagataaatttcattgtaagtgatgtaat |
40808972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University