View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_94 (Length: 310)
Name: NF11278_low_94
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_94 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 298
Target Start/End: Complemental strand, 12031032 - 12030753
Alignment:
| Q |
19 |
ggatcactagttctccctgattcttctgagggcccaactgaattgcagttgcataaggtgtgttgtggattgctgctgagagttatttgaaaatccttgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12031032 |
ggatcactagttctccctgattcttctgagggcccaactgaattgcagttgcataaggtgtgttgtggattgctgctgagggttatttgaaaatccttgc |
12030933 |
T |
|
| Q |
119 |
acaatagtctgactgccttgcttcttgaggctcatggcaaccatcttctccggtagatcttttggtatagggctaaattgactaccactgatgaatttca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |||||||||| |||||| |
|
|
| T |
12030932 |
acaatagtctgactgccttgcttcttgaggctcatggcaaccatcttctccagtagatcttttggtatagggctaaattggccaccactgatggatttca |
12030833 |
T |
|
| Q |
219 |
tagggttactactaaaagtattctccttcctttcaataattcttctaccatagttccttgatctcagccaagctccccta |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12030832 |
tagggttactactaaaagtattctccttcctttcaataattcttctaccatagttccttgatctcagccaagctccccta |
12030753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University