View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11279_high_26 (Length: 307)
Name: NF11279_high_26
Description: NF11279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11279_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 235 - 293
Target Start/End: Complemental strand, 8179735 - 8179674
Alignment:
| Q |
235 |
atggagtgcaagttc---atttccttgctggctgaatcttgacgagttgtagaccaagtttg |
293 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8179735 |
atggagtgcaagttcttcatttccttgctggctgaatcttgacgagttgtagaccaagtttg |
8179674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 122 - 161
Target Start/End: Complemental strand, 8195527 - 8195488
Alignment:
| Q |
122 |
aaaattgatttacggaaaagttcattctcataacgtttta |
161 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8195527 |
aaaattgatttaaggaaaagttcattctcataacgtttta |
8195488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 52 - 94
Target Start/End: Complemental strand, 8195621 - 8195579
Alignment:
| Q |
52 |
ataaatgaatttcatcaaatgtatgtgctacctgattgttttt |
94 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
8195621 |
ataaatgaatttcaacaaatgtatgtgctacctaattgttttt |
8195579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 12 - 50
Target Start/End: Complemental strand, 8195725 - 8195687
Alignment:
| Q |
12 |
ataggatggaaaaagtaatagtcaaaaaataaatcattt |
50 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8195725 |
atagggtggaaaaagtaatagtcaaaaaataaatcattt |
8195687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University