View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11279_high_31 (Length: 281)
Name: NF11279_high_31
Description: NF11279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11279_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 53 - 269
Target Start/End: Original strand, 16166921 - 16167136
Alignment:
| Q |
53 |
aatagaaccataaaaaccaggaagatagatatcattgaacattgaatccgaaaaaccatagaactcgaaaagacattgttatcttctttagtggtcttct |
152 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
16166921 |
aatagaaccataaaaacctggaagatagatatcattgaacattgaatc-gaaaaaccatagaactcgaaaagacattgttatcttcttcaacggtcttct |
16167019 |
T |
|
| Q |
153 |
tcttcatgtctatttcaaagatggatttctccgaaatttgtccaacttgtttcagaaaaatagaacggtttccaactgtttaggcaataggatccttcct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
16167020 |
tcttcatgtctatttcaaagatggatttctccgaaatttgtccaacttgtttcagaaaaatagaatggtttccaactgttcaggcaataggatccttcct |
16167119 |
T |
|
| Q |
253 |
agatcacttggtatctc |
269 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
16167120 |
atatcacttggtatctc |
16167136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University