View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11279_high_35 (Length: 261)

Name: NF11279_high_35
Description: NF11279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11279_high_35
NF11279_high_35
[»] chr5 (1 HSPs)
chr5 (200-251)||(33363224-33363275)


Alignment Details
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 33363275 - 33363224
Alignment:
200 atttcgaaccagcagcaacttagtgcaatacagatttatcatgtgacctttg 251  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||    
33363275 atttcgaaccagcagcaacttagtgcaatgcagatttatcatgtgacctttg 33363224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University