View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11279_high_52 (Length: 211)

Name: NF11279_high_52
Description: NF11279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11279_high_52
NF11279_high_52
[»] chr8 (1 HSPs)
chr8 (15-193)||(5525025-5525203)


Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 5525203 - 5525025
Alignment:
15 gaagaaaggacgttggggatggtagaggaagtagacgacggtgccagcgacgccgaggaggatgaggatgaagatgaggatgagaagaagccagcaacaa 114  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
5525203 gaaggaaggacgttggggatggtagaggaagtagacgacggtgccagcgacgccgaggaggatgaggacgaagatgaggatgagaagaagccagcaacaa 5525104  T
115 atggtgcaacaccagttacggttgttacggtaacggtgggtttgtggacggtaggttggccgggttgcaccgtagattt 193  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| || ||||||||||    
5525103 atggtgcaacaccagttacggttgttacggtgacggtgggtttgtggacggtaggttgggcgggtggcgccgtagattt 5525025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University