View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11279_low_26 (Length: 329)
Name: NF11279_low_26
Description: NF11279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11279_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 21 - 173
Target Start/End: Original strand, 36953618 - 36953770
Alignment:
| Q |
21 |
tggttcaatgcctggttacagttcaaaaaacccttaaatcctaacacaatcctacccaaccatgacattggagaaacattcttaattgaatctctaaata |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36953618 |
tggttcaatgcctggttacagttcaaaaaacccttaaatcctaacacaatcctacccaaccatgacattggagaaacattcttaattgaatctctaaata |
36953717 |
T |
 |
| Q |
121 |
catatatgcactaaaatgtatgacaagtagactagtgaagcttttgctcactc |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36953718 |
catatatgcactaaaatgtatgacaagtagactagtgaagcttttgctcactc |
36953770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 238 - 322
Target Start/End: Original strand, 36953835 - 36953919
Alignment:
| Q |
238 |
cacacccacagtagctggccattatctccagcgagatcttcatattcaatatttttaagatcgttgagatttccatcaatctgtg |
322 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36953835 |
cacacccatagtagctggccattatctccagcgagatcttcatattcaatatttttaagatcgttgagatttccatcaatctgtg |
36953919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University