View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11279_low_38 (Length: 261)
Name: NF11279_low_38
Description: NF11279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11279_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 33363275 - 33363224
Alignment:
| Q |
200 |
atttcgaaccagcagcaacttagtgcaatacagatttatcatgtgacctttg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33363275 |
atttcgaaccagcagcaacttagtgcaatgcagatttatcatgtgacctttg |
33363224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University