View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11279_low_41 (Length: 249)

Name: NF11279_low_41
Description: NF11279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11279_low_41
NF11279_low_41
[»] chr7 (1 HSPs)
chr7 (185-242)||(43391929-43391986)


Alignment Details
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 185 - 242
Target Start/End: Complemental strand, 43391986 - 43391929
Alignment:
185 ctttatctttctattacatcaacaaatatctcatctatcacgtgactttattcatctc 242  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
43391986 ctttatctttctattacatcaacaaatatctcatctatcacgtgactttatccatctc 43391929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University