View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11279_low_49 (Length: 240)
Name: NF11279_low_49
Description: NF11279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11279_low_49 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 9 - 240
Target Start/End: Complemental strand, 55300597 - 55300366
Alignment:
| Q |
9 |
ggagcagagagaggagggggaagtgggaacaggaagagcaataagacccctatagtatggacttgagtcgtgataacaagaaagggatgagttgtgatgg |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
55300597 |
ggagaagagagaggagggggaagtgggaacaggaagagcaataagacccctatagtatggacttgagtcgtgataacaagaaagggatgagttatgatgg |
55300498 |
T |
 |
| Q |
109 |
gggtggggatgaggagtggcccaagaggcatcaatgacaagagagtaatcggtaagacctttgtagtaaggactactgtagggggatgatgaaacgagga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
55300497 |
gggtggggatgaggagtggcccaagaggcatcaatgacaagagaataatcggtaagacctttgtagtaaggactactgtggggggatgatgaaaggagga |
55300398 |
T |
 |
| Q |
209 |
taggtcgcagtgatgaagagatattgttgttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55300397 |
taggtcgcagtgatgaagagatattgttgttg |
55300366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University