View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11279_low_52 (Length: 227)

Name: NF11279_low_52
Description: NF11279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11279_low_52
NF11279_low_52
[»] chr7 (2 HSPs)
chr7 (18-214)||(30120626-30120829)
chr7 (55-185)||(29856531-29856660)
[»] chr5 (1 HSPs)
chr5 (17-214)||(29260814-29261011)
[»] chr8 (1 HSPs)
chr8 (48-189)||(41311468-41311607)
[»] chr2 (1 HSPs)
chr2 (47-189)||(21425978-21426120)
[»] chr4 (2 HSPs)
chr4 (94-168)||(7822582-7822656)
chr4 (100-168)||(7813093-7813161)


Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 30120626 - 30120829
Alignment:
18 ggaaacaatcatttcctatggacaaaaggttatgtgtgggtgaggcggcaagataaaaatgtaaagttgcgaaattgggatg-------agagatgagag 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||       |||||||||||    
30120626 ggaaacaatcatttcctatggacaaaaggttatgtgtgggtgaggcggcaagatgaaaatgtaaagttgcaaaattgggatgagagatgagagatgagag 30120725  T
111 acagccatgatttgcaaacgcacctgtaacgtagtacatacttcaccggcaacctcaataggatttctgttatcacttccggaagcagatgcaggcttct 210  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||    
30120726 acagccatgatttgcaaacgcacctgtaacgtaatacatacttcaccggcaacctcaataggatttctgttatcactttcggaagcagatgcacgcttct 30120825  T
211 tctc 214  Q
    ||||    
30120826 tctc 30120829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 55 - 185
Target Start/End: Complemental strand, 29856660 - 29856531
Alignment:
55 gggtgaggcggcaagataaaaatgtaaagttgcgaaattgggatgagagatgagagacagccatgatttgcaaacgcacctgtaacgtagtacatacttc 154  Q
    |||||| || ||||||| ||||||| ||||||  ||||  ||||||||||| | ||| | |||| | || || |||| | || ||||||||||| |||||    
29856660 gggtgatgcagcaagatgaaaatgtgaagttga-aaatgaggatgagagatcatagaaatccataacttacagacgcgcttgcaacgtagtacagacttc 29856562  T
155 accggcaacctcaataggatttctgttatca 185  Q
    |||||||||||||  |||||||| |||||||    
29856561 accggcaacctcatcaggatttcggttatca 29856531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 214
Target Start/End: Complemental strand, 29261011 - 29260814
Alignment:
17 aggaaacaatcatttcctatggacaaaaggttatgtgtgggtgaggcggcaagataaaaatgtaaagttgcgaaattgggatgagagatgagagacagcc 116  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||||||||    
29261011 aggaaacaataatttcctatggacaaaaggttatgtgtgggtgaggcggcaagatgaaaatgtaaagttgcaaaattgggatgagaaatgagagacagcc 29260912  T
117 atgatttgcaaacgcacctgtaacgtagtacatacttcaccggcaacctcaataggatttctgttatcacttccggaagcagatgcaggcttcttctc 214  Q
    |||||||| |||  ||| ||||||||||||||||||||||  |||||||| ||||||| |||||||||||||||||||||||||||| |||| |||||    
29260911 atgatttgtaaatacacttgtaacgtagtacatacttcacgagcaacctctataggatctctgttatcacttccggaagcagatgcacgctttttctc 29260814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 48 - 189
Target Start/End: Original strand, 41311468 - 41311607
Alignment:
48 tatgtgtgggtgaggcggcaagataaaaatgtaaagttgcgaaattgggatgagagatgagagacagccatgatttgcaaacgcacctgtaacgtagtac 147  Q
    ||||||||| ||| || ||||| | ||||||| ||| ||| |||| ||||| |||||| ||||| |||||||| || || ||||  ||| ||||||||||    
41311468 tatgtgtggatgatgcagcaagttgaaaatgtgaagatgccaaatagggatcagagattagagagagccatgacttacagacgc--ctgcaacgtagtac 41311565  T
148 atacttcaccggcaacctcaataggatttctgttatcacttc 189  Q
    | ||||||||||||||||||  |||||||| |||||||||||    
41311566 agacttcaccggcaacctcagcaggatttcggttatcacttc 41311607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 47 - 189
Target Start/End: Complemental strand, 21426120 - 21425978
Alignment:
47 ttatgtgtgggtgaggcggcaagataaaaatgtaaagttgcgaaattgggatgagagatgagagacagccatgatttgcaaacgcacctgtaacgtagta 146  Q
    ||||||||||| ||||| ||||| | ||||||| ||||||  ||||  ||||||||||||| ||| |||||| | || || || |||||| | |||||||    
21426120 ttatgtgtgggagaggcagcaagttgaaaatgtgaagttgaaaaatgaggatgagagatgatagaaagccataacttacagacacacctgcagcgtagta 21426021  T
147 catacttcaccggcaacctcaataggatttctgttatcacttc 189  Q
     |  |||||||||||||||||  ||||||||  ||||||||||    
21426020 aagtcttcaccggcaacctcagaaggatttcctttatcacttc 21425978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 94 - 168
Target Start/End: Complemental strand, 7822656 - 7822582
Alignment:
94 gggatgagagatgagagacagccatgatttgcaaacgcacctgtaacgtagtacatacttcaccggcaacctcaa 168  Q
    ||||| |||||| ||||| | ||||||||| ||||| ||| || ||||||  | |||||||||||||||||||||    
7822656 gggatcagagataagagaaaaccatgatttacaaacacacttgaaacgtataagatacttcaccggcaacctcaa 7822582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 168
Target Start/End: Complemental strand, 7813161 - 7813093
Alignment:
100 agagatgagagacagccatgatttgcaaacgcacctgtaacgtagtacatacttcaccggcaacctcaa 168  Q
    |||||| ||||| | ||||||||| ||||| ||| || ||||||  | |||||||||||||||||||||    
7813161 agagataagagaaaaccatgatttacaaacacacttgaaacgtataagatacttcaccggcaacctcaa 7813093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University