View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11279_low_55 (Length: 211)
Name: NF11279_low_55
Description: NF11279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11279_low_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 5525203 - 5525025
Alignment:
| Q |
15 |
gaagaaaggacgttggggatggtagaggaagtagacgacggtgccagcgacgccgaggaggatgaggatgaagatgaggatgagaagaagccagcaacaa |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5525203 |
gaaggaaggacgttggggatggtagaggaagtagacgacggtgccagcgacgccgaggaggatgaggacgaagatgaggatgagaagaagccagcaacaa |
5525104 |
T |
|
| Q |
115 |
atggtgcaacaccagttacggttgttacggtaacggtgggtttgtggacggtaggttggccgggttgcaccgtagattt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| || |||||||||| |
|
|
| T |
5525103 |
atggtgcaacaccagttacggttgttacggtgacggtgggtttgtggacggtaggttgggcgggtggcgccgtagattt |
5525025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University