View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_high_30 (Length: 255)
Name: NF11280A_high_30
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_high_30 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 255
Target Start/End: Original strand, 43023940 - 43024179
Alignment:
| Q |
16 |
atagtgtgaagagacaaatcccaatcaatactgctgtgccaagaaaacgatccatcagaggcgcaagttagtagagatcaacatcgcacttggtgggcac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43023940 |
atagtgtgaagagacaaatcccaatcaatactgctgtgccaagaaaacgatccatcagaggcgcaagttagtagagatcaacatcgcacttggtgggcac |
43024039 |
T |
 |
| Q |
116 |
aagctgagtggaggtattcttagaattcaaaggaactttgaggtcacatttcactttcggattgatacgaccaaatatcacattcccgagtctgaatcta |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43024040 |
aagctgagtgaaggtattcttagaattcaaaggaactttgaggtcacatttcactttcggattgatacgaccaaatatcacattcccgagtctgaatcta |
43024139 |
T |
 |
| Q |
216 |
atttcgaagtagagtttcacatagatatcataaacttcaa |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43024140 |
atttcgaagtagagtttcacatagatatcataaacttcaa |
43024179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University