View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11280A_high_38 (Length: 212)

Name: NF11280A_high_38
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11280A_high_38
NF11280A_high_38
[»] chr6 (1 HSPs)
chr6 (23-191)||(6585520-6585688)
[»] chr4 (1 HSPs)
chr4 (26-69)||(51169285-51169328)


Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 23 - 191
Target Start/End: Original strand, 6585520 - 6585688
Alignment:
23 atgtattcatgaaaacagtgaaggacttgatgctggaagttcagacggtaatcaccagaagagagattctactcaagtatctactctcagaaattcaact 122  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6585520 atgtattcatgaaaacggtgaaggacttgatgctggaagttcagacggtaatcaccagaagagagattctactcaagtatctactctcagaaattcaact 6585619  T
123 ttatgttccggtgcttctgatgagttcttatgtgtcaaatgtttcacatatttcagttcaacgggggat 191  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
6585620 ttatgttccggtgcatctgatgagttcttatgtgtcaaatgtttcacagatttcagttcaacgggggat 6585688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 69
Target Start/End: Complemental strand, 51169328 - 51169285
Alignment:
26 tattcatgaaaacagtgaaggacttgatgctggaagttcagacg 69  Q
    |||||||| |||||||  ||||||||||||||||||||||||||    
51169328 tattcatgcaaacagtagaggacttgatgctggaagttcagacg 51169285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University