View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_high_38 (Length: 212)
Name: NF11280A_high_38
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_high_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 23 - 191
Target Start/End: Original strand, 6585520 - 6585688
Alignment:
| Q |
23 |
atgtattcatgaaaacagtgaaggacttgatgctggaagttcagacggtaatcaccagaagagagattctactcaagtatctactctcagaaattcaact |
122 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6585520 |
atgtattcatgaaaacggtgaaggacttgatgctggaagttcagacggtaatcaccagaagagagattctactcaagtatctactctcagaaattcaact |
6585619 |
T |
|
| Q |
123 |
ttatgttccggtgcttctgatgagttcttatgtgtcaaatgtttcacatatttcagttcaacgggggat |
191 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6585620 |
ttatgttccggtgcatctgatgagttcttatgtgtcaaatgtttcacagatttcagttcaacgggggat |
6585688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 69
Target Start/End: Complemental strand, 51169328 - 51169285
Alignment:
| Q |
26 |
tattcatgaaaacagtgaaggacttgatgctggaagttcagacg |
69 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
51169328 |
tattcatgcaaacagtagaggacttgatgctggaagttcagacg |
51169285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University