View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_100 (Length: 307)
Name: NF11280A_low_100
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_100 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 9e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 37 - 143
Target Start/End: Complemental strand, 15078280 - 15078174
Alignment:
| Q |
37 |
aaatttctcacctttggcggaattttcgctcgccacacaccaccccaatcacttggaaccttgcgtctttcaccctttgtcgacatgcacatagcacaat |
136 |
Q |
| |
|
||||| ||||||||||||| || ||| |||||| |||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
15078280 |
aaattcctcacctttggcgaaacttttgctcgctacacaccaccccaatcacctggaaccttgtgtctttccgtctttgtcgacatgcacatagcacaat |
15078181 |
T |
|
| Q |
137 |
gataccc |
143 |
Q |
| |
|
||||||| |
|
|
| T |
15078180 |
gataccc |
15078174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 199 - 249
Target Start/End: Original strand, 26793083 - 26793133
Alignment:
| Q |
199 |
tccaacttgactgtattgaactcaatgaaggatcttgtatgactcttactt |
249 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| |||| |||||||| |
|
|
| T |
26793083 |
tccaacttgattgtattgacctcaatgaaggatcttgcatgattcttactt |
26793133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University