View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_107 (Length: 297)
Name: NF11280A_low_107
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_107 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 152 - 285
Target Start/End: Complemental strand, 32265528 - 32265400
Alignment:
| Q |
152 |
ctttcatgttaataatggaacatgacaatttcatagtttcttcattccattgaaatttttgtttcacctttcctttcattggttcaatcaatattccatt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
32265528 |
ctttcatgttaataatggaacatgacaatttcatagtttcttcattccattgaaatttttgtttcacc-----tttcattgattcaatcaatattccatt |
32265434 |
T |
 |
| Q |
252 |
ggacatgtttttctttttcagcgatatcaatatt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32265433 |
ggacatgtttttctttttcagcgatatcaatatt |
32265400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 27 - 87
Target Start/End: Complemental strand, 32265654 - 32265594
Alignment:
| Q |
27 |
ttggcattatcacatatgatgaaagcatttgcaatgtacagaaagccatgtgggttaatga |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32265654 |
ttggcattatcacatatgatgaaagcatttgcaatgtacagaaagccatgtgggttaatga |
32265594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University