View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_11 (Length: 455)
Name: NF11280A_low_11
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 252 - 450
Target Start/End: Complemental strand, 9569646 - 9569448
Alignment:
| Q |
252 |
gagtaggagctaaggtggcagtgttagggaaattcattaatggccgatttgatgggatcacgggcatactgctgcttcaagtgctaaaaccttgttgctt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9569646 |
gagtaggagctaaggtggcagtgttagggaaattcattaatggccgatttgatgggatcacgggcatactgctgcttcaagtgccaaaaccttgttgctt |
9569547 |
T |
|
| Q |
352 |
tccatgatgatattgtttccaaagattttcaggtgaacttttctttcttgcaattttgactttttcttcatctttatgctagattttgttgaaaatggt |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9569546 |
tccatgatgatattgtttccaaagattttcaggtgaacttttctttcttgcaattttgactttttcttcatctttatgctagattttgttgaaaatggt |
9569448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 168; E-Value: 7e-90
Query Start/End: Original strand, 7 - 182
Target Start/End: Complemental strand, 9570050 - 9569875
Alignment:
| Q |
7 |
ccaattcttttggaatcttctttactcaatcacccttctcattcatattctttgcttcaaattatttttcattaattcagtacatatcttgcaccaaacc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9570050 |
ccaattcttttggaatcttctttactcaatcacccttctcattcatattctttgcttcaaattatttttcattaattcagtacatatcttgcaccaaacc |
9569951 |
T |
|
| Q |
107 |
aattatcaaactctgacatgaaaaatttggctgctagtgttttgtcataactgtgtaacagacactttgaccaagc |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
9569950 |
aattatcaaactctgacatgaaaaatttggctgctagtgttttgtcaaaactgtgtaacagaaactttgaccaagc |
9569875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University