View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_115 (Length: 292)
Name: NF11280A_low_115
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_115 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 72 - 195
Target Start/End: Original strand, 1140352 - 1140475
Alignment:
| Q |
72 |
tttcctgttaattcctgtttttgccctcgtgaatccatgctacctatggaacccatctctctctagtgtgaaagtttccattttaatatcaaaagagaaa |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
1140352 |
tttcctgttaattcctgtttttgccctcgtgaatccatgctacctatggaacccatctctctctagtgtgaatgtttcttttttaatatcaaaagagaaa |
1140451 |
T |
 |
| Q |
172 |
tacatgtgaaagttagtttgagtc |
195 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
1140452 |
ttcatgtgaaagttagtttgagtc |
1140475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 192 - 253
Target Start/End: Original strand, 1140516 - 1140577
Alignment:
| Q |
192 |
agtccctgcatccaatcaatgacaaccaaatagttagaaagaaagaaacagttatatcaaaa |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||| |
|
|
| T |
1140516 |
agtccctgcatccaatcaatgacaaccaaatagttataaagaaagaaacatttatattaaaa |
1140577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 43 - 75
Target Start/End: Original strand, 1140240 - 1140272
Alignment:
| Q |
43 |
cactcttgacgatttaatggacggtttcttttc |
75 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
1140240 |
cactcttcacgatttaatggacggtttcttttc |
1140272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University