View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_116 (Length: 292)
Name: NF11280A_low_116
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_116 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 9 - 147
Target Start/End: Complemental strand, 41006809 - 41006671
Alignment:
| Q |
9 |
aatgaatggattcccatgcttgttatggactgcttgtctgagagaaggtggagaaccagcttcccataataagccaattgtcatatctccttgaaagcta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41006809 |
aatgaatggattcccatgcttgttatggactgcttgtctgagagaaggtggagaaccggcttcccataataagccaattgtcatatctccttgaaagcta |
41006710 |
T |
 |
| Q |
109 |
cttcctgatagtgatgtagatattatatccgttgccata |
147 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41006709 |
cttcctgatagttatgtagatattatatccgttgccata |
41006671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 189 - 287
Target Start/End: Complemental strand, 41006629 - 41006531
Alignment:
| Q |
189 |
gatgtgagtcttaaaaacttgaagttcaaaaaagaggtaaataatcaggggcggatttatgtgggagctatgtgagactatagctctccacatgctttt |
287 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41006629 |
gatgtgagtcttaaaaacatgaagttcaaaaaagaggtaaataatcaggggcggatttatgtgggagctatgtgagactatagctctccacatgctttt |
41006531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University