View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_119 (Length: 291)
Name: NF11280A_low_119
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_119 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 14 - 291
Target Start/End: Complemental strand, 11156502 - 11156225
Alignment:
| Q |
14 |
atcatgaagttcatagaagaaagtaaatgcaagcacttattccatcttgttttcaaatggcaaggaactatgtgaggtgacttaaaagccaaggtagcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11156502 |
atcatgaagttcatagaagaaagtaaatgcaagcacttattccatcttgttttcaaatggcaaggaactatgtgaggtgacttaaaagccaaggtagcaa |
11156403 |
T |
 |
| Q |
114 |
gttttgaatcacattcaatcaagagatgatgccagttattgttgtgagtagtttcaatagctaaaataactcccataatcccagcattaagagcattaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11156402 |
gttttgaatcacattcaatcaagagatgatgccagttattgttgtgagtagtttcaatagctaaaataactcccataatcccagcaataagagcattaga |
11156303 |
T |
 |
| Q |
214 |
aatgatatgccaaggttgagggcaaaacatcccaaaattatcgccattgcagtttctgaaaataccagcacaagcatc |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11156302 |
aatgatatgccaaggttgagggcaaaacatcccaaaattatcgccattgcagtttctgaaaataccagcacaagcatc |
11156225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University