View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_127 (Length: 287)
Name: NF11280A_low_127
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_127 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 20 - 170
Target Start/End: Original strand, 31114516 - 31114667
Alignment:
| Q |
20 |
cttttctcccaatcaaataagcttt-agaaccaatgtccattcaaagaggtggatcccattatgccactcactctccattatctgcattgatgatagaag |
118 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114516 |
cttttctcccaatcaaataagcttttagaaccaatgtcctttctaagagttgggtcccattatgccactcactctccattatctgcattgatgatagaag |
31114615 |
T |
 |
| Q |
119 |
cttgtatcccataaacacagtgaactgggttcactttggacgattcatggac |
170 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31114616 |
cttgtatcccagaaacacagtgaactgggttcactttggtcgattcatggac |
31114667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 238 - 287
Target Start/End: Original strand, 31114681 - 31114730
Alignment:
| Q |
238 |
ataaatgggttgaagcatcaaaacgacgtcatctttatctatccttggtt |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114681 |
ataaatgggttgaagcatcaaaacgacgtcatctttatctatccttggtt |
31114730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 85 - 197
Target Start/End: Original strand, 31088499 - 31088611
Alignment:
| Q |
85 |
actcactctccattatctgcattgatgatagaagcttgtatcccataaacacagtgaactgggttcactttggacgattcatggacgcaattatgttcaa |
184 |
Q |
| |
|
|||||||||| || || || ||||||||| |||||| |||| | |||||||| ||| |||||||||||| | ||||| |||| ||||||||||||| |
|
|
| T |
31088499 |
actcactctctgttgtccgctttgatgatataagcttctatcaaagaaacacagagaagtgggttcactttcgttgattcgtggatacaattatgttcaa |
31088598 |
T |
 |
| Q |
185 |
cccccactctcaa |
197 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
31088599 |
cccacactctcaa |
31088611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University