View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_129 (Length: 286)
Name: NF11280A_low_129
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_129 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 2 - 277
Target Start/End: Original strand, 25210962 - 25211237
Alignment:
| Q |
2 |
atatatcacttctgcaaatcacccagcaaaacagccctcttgcttgagaggatacattagcaatgcaaacttctgtaatgttggttatgatatacatttc |
101 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25210962 |
atatgtcactcctgcaaatcacccagcaaaacagccctcttgcttgagaggatacattagcaatgcaaacttctgtgatgttggttatgatatacatttc |
25211061 |
T |
|
| Q |
102 |
tggttgaaacaggtagcttaattacaggataattttattaaaaaccagttaacagtgcataggccatgccattcacattttcttcatttgattctattga |
201 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25211062 |
tggttgaaacaggtagcttaattacaggaaaattttattaaaaaccagttaacagtgcataggccatgccattcacattttcttcatttgattctattga |
25211161 |
T |
|
| Q |
202 |
aatttaatttgcatggcaaggctacttattctctttggagtttaagatttgagtctcaactatttacaagtcaaga |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25211162 |
aatttaatttgcatggcaaggctacttattctctttggagtttaagatttgattctcaactatttacaagtcaaga |
25211237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University