View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_173 (Length: 259)
Name: NF11280A_low_173
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_173 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 1954203 - 1954418
Alignment:
| Q |
18 |
gatagtcttgcctaatattattcaaaattatgatcttttttacctatagacaatattcagggtgtaaatgttcgacacctacaattttgaagggcaaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||| | ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
1954203 |
gatagtcttgcctaatattattcaaaattatgatct-----acctatagacaaaatttaaggtgtaaatgtccgacgcctacaattttgaagggcaaatt |
1954297 |
T |
 |
| Q |
118 |
gatgatctactcataatatatctatcaaatgttctacattcactccattatgttatatgtaacaccaaagaatacacaaaatacaaatacaaacttggac |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1954298 |
gatgatttactcataatatatctatcaaatgttctacattcactccattatgttatatgtaacaccaaagaatacacaaaatacaaatacaaactttgac |
1954397 |
T |
 |
| Q |
218 |
actttatatacattgaggatt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1954398 |
actttatatacattgaggatt |
1954418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University