View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_18 (Length: 428)
Name: NF11280A_low_18
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 5e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 286 - 423
Target Start/End: Complemental strand, 13945870 - 13945735
Alignment:
| Q |
286 |
ttcataatataaaaagtcatgattacaaagattgatatacatgcccctatttaaccttttaatggctcaacagggacaaatgacccaccattataacata |
385 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13945870 |
ttcataatataaaa-gtcatgattacaaagattgata-acatgcccctatttaaccttttaatggctcaacagggacaaatgacccaccattataacata |
13945773 |
T |
 |
| Q |
386 |
atcaagccaaacattatattatattttatttttgttgt |
423 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13945772 |
atcaagccaaacattatattatattatatttttgttgt |
13945735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University