View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_184 (Length: 254)
Name: NF11280A_low_184
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_184 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 3 - 170
Target Start/End: Original strand, 32790349 - 32790516
Alignment:
| Q |
3 |
tcgactgatatgaacacttgtatgtatatcaacatcgtgcaaaaagactggaaaattaaacaggtaaataagaaataacctgtcgcccttcggtttcctc |
102 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32790349 |
tcgactgacatgaacacttgtatgtatatcaacatcgtgcaaaaagactggaaaattaaacaggcaaataagaaataacctgtcgcccttcggtttcctc |
32790448 |
T |
 |
| Q |
103 |
atgcgatcgccattagctttggatacagcatcaatttcagctcgaatttgacgcatctaggattgtat |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32790449 |
atgcgatcgccattagctttggatacagcaccaatttcagctcgaatttgacgcatctaggattgtat |
32790516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 41 - 110
Target Start/End: Original strand, 48283665 - 48283734
Alignment:
| Q |
41 |
gcaaaaagactggaaaattaaacaggtaaataagaaataacctgtcgcccttcggtttcctcatgcgatc |
110 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48283665 |
gcaaaaagactgggaaattaaacaagtaaataagaaataacctgtcgccctttggtttcctcatgcgatc |
48283734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 112 - 167
Target Start/End: Original strand, 48284253 - 48284308
Alignment:
| Q |
112 |
ccattagctttggatacagcatcaatttcagctcgaatttgacgcatctaggattg |
167 |
Q |
| |
|
|||| |||||||||||||||| |||| || ||||||||||| |||||||||||||| |
|
|
| T |
48284253 |
ccatcagctttggatacagcaccaatctctgctcgaatttgtcgcatctaggattg |
48284308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University