View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_192 (Length: 251)
Name: NF11280A_low_192
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_192 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 9 - 251
Target Start/End: Complemental strand, 41103375 - 41103133
Alignment:
| Q |
9 |
gagatgaacaacatcggagaatcgtgtttcgctgatatttgcagagaaagcgcactgatgctgtttgcattcccggaaaacgtggcaaaatgcaagaaaa |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103375 |
gagaagaacaacatcggagaatcgtgtttcgctgatatttgcagagaaagcgcattaatgctgtttgcattcccggaaaacgtggcaaaatgcaagaaaa |
41103276 |
T |
|
| Q |
109 |
ctccggagaaaatgttcagaacgcttgatttatacgaagcgatttcagaaaattggaatcaaattgaatcaattttttcgtcggaatcaaactcaccgat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103275 |
ctccggagaaaatgttcagaacgcttgatttatacgaagcgatttcagaaaattggaatcaaattgaatcaattttttcgtcggaatcaaactcaccgat |
41103176 |
T |
|
| Q |
209 |
aagatcgcaagtcgttgcttcacaggttagactcggtgaaacg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103175 |
cagatcgcaagtcgttgcttcacaggttagactcggtgaaacg |
41103133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 93 - 157
Target Start/End: Complemental strand, 23129108 - 23129044
Alignment:
| Q |
93 |
gcaaaatgcaagaaaactccggagaaaatgttcagaacgcttgatttatacgaagcgatttcaga |
157 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
23129108 |
gcaaaatgcaagaaaactcctgagaaaatgttcagaactcttgatttatacgaagcaatttcaga |
23129044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University