View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_204 (Length: 250)
Name: NF11280A_low_204
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_204 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 6 - 242
Target Start/End: Original strand, 53096639 - 53096875
Alignment:
| Q |
6 |
gtttggtgttgcaaatagcagcattcagccaatgtggagctttagcggcagcagaagaccttaagnnnnnnnntccatcgaatttggatgagcagaaatg |
105 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53096639 |
gtttggagttgcaaatagcagcattcagccaatgtggagctttagcggcagcagaagaccttaagaaaaaaaatccatcgaatttggatgagcagaaatg |
53096738 |
T |
|
| Q |
106 |
aagggggtggaggaaattaggctacataacaaggtcaaaatgaagttgagtaaaagaaatttactgcaaacaagaagcattagttgcatgcgtcgagcct |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
53096739 |
aagggggtggaggaaattaggctacataacaaggtcaaaatgaagttgagtaaaagaaatttactgcaaacaagaagcattagttgcatacgtcgagcct |
53096838 |
T |
|
| Q |
206 |
ggcaataatgttagaccttcggttaaaacaacaaaag |
242 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
53096839 |
ggcaataatgttagaccttctgttaaaacaaccaaag |
53096875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University