View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_223 (Length: 246)
Name: NF11280A_low_223
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_223 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 7 - 246
Target Start/End: Complemental strand, 13140212 - 13139973
Alignment:
| Q |
7 |
gtagcaaagatatgtgcttatgactcaaggcaattttcgaaagaaatcatgggaatgagtgttttggccatgactgtaattgtgatctgtttgccagaac |
106 |
Q |
| |
|
|||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13140212 |
gtagcaaatagatgtgcttatgactcaaggcatttttcgaaagaaatcatgggaatgagtgttttggccatgattgtaattgtgatctgtttgccagaac |
13140113 |
T |
|
| Q |
107 |
caaggggtctttctgtggaaaccttcacgaacaatcgttgttttttgatggtttttctgcttctcatcgctgctctttccacacctccggatatctgatg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13140112 |
caaggggtctttctgtggaaaccttcacgaacaatcgttgttttttgatggtttttccgcttctcaccgctgctctttccacacctccggatatctgatg |
13140013 |
T |
|
| Q |
207 |
ccaaatcgtcgcctgtttcctaatttcttcgataattgag |
246 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
13140012 |
ccaaatcgtcgcatgtttccttatttcttcgataattgag |
13139973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University