View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_242 (Length: 242)
Name: NF11280A_low_242
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_242 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 7 - 236
Target Start/End: Complemental strand, 28529769 - 28529534
Alignment:
| Q |
7 |
catgtatgtgtcggtgcttcatag----atattgagaaattacctggagaagaatgtttaagaaaaatacaaacacattcatgcttctaagcaaaacaag |
102 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
28529769 |
catgcatgtgtcggtgcttcatagctagatattgagaaattacctggagaagaatgtttaagaaatatacaaaatcattcatgcttctaagcaaaacaag |
28529670 |
T |
|
| Q |
103 |
tgtttctgtcattctccagtcgatagcaatacaattaaagtcctgcacacactgaatgggaaatggtgagtaaat--ttacaacnnnnnnnngtagcagg |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||| |||||||| |
|
|
| T |
28529669 |
tgtttctgtcattctccagtcaatagcaatacaattaaagtcctgcacacaatgaatgggaaatggtgagtaaattataacaacaaaagaaagtagcagg |
28529570 |
T |
|
| Q |
201 |
agagtactggcattttcatattgaaatattcttcga |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28529569 |
agagtactggcattttcatattgaaatatttttcga |
28529534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University