View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_251 (Length: 239)
Name: NF11280A_low_251
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_251 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 223
Target Start/End: Original strand, 54608253 - 54608456
Alignment:
| Q |
20 |
ttatttatttattatattaggatgatcctgcaagaactagaatttcccatacatatattggatctgctgctcttcttcaccgtatatgccatatctccat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54608253 |
ttatttatttattatattaggatgatcctgcaagaactagaatttcccatacatatattggatctgctgctcttcttcaccgtatatgccatatctccat |
54608352 |
T |
|
| Q |
120 |
cacccaattattaatctgcaggctcatatacatatataaagtagataagataagaagcaggctttacaattagnnnnnnncaacatattgtcattggttc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54608353 |
cacccaattattaatctgcaggctcatatacatatataaagtagataagataagaagcaggctttacaattagtttttttcaacatattgtcattggttc |
54608452 |
T |
|
| Q |
220 |
attt |
223 |
Q |
| |
|
|||| |
|
|
| T |
54608453 |
attt |
54608456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University