View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_255 (Length: 238)
Name: NF11280A_low_255
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_255 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 220
Target Start/End: Original strand, 43804658 - 43804858
Alignment:
| Q |
20 |
cttagagagtggagggtggtgcatcaggaaaatgggcaggctgctcgtctacaacagcctgttcagaatggtcaaacatggcagggacacgtctatttct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43804658 |
cttagagagtggagggtggtgcatcaggaaaatggacaggctgctcgtctacaacagcctgttcagaatggtcaaacatggcagcgacacgtctatttct |
43804757 |
T |
 |
| Q |
120 |
gagcagcacaattagattggaattgagatttgcgtaagggacgcatatgaaatatttatgggagaaaaactttgtgggtgcaacctatcttgtatgttaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43804758 |
gagcagcacaattagattggaattgagatttgcttaagggacgcatatgaaatatttatgggagaaaaactttgtgggtgcaacctatcttgaatgttaa |
43804857 |
T |
 |
| Q |
220 |
g |
220 |
Q |
| |
|
| |
|
|
| T |
43804858 |
g |
43804858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University