View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_261 (Length: 235)
Name: NF11280A_low_261
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_261 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 6 - 215
Target Start/End: Original strand, 23863985 - 23864193
Alignment:
| Q |
6 |
aactaccctataagcttattttatacgtccttaattaattattattataacggcattaccgttgatataaaactattagtatcgttgagtaatgaccctt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23863985 |
aactaccctataagcttattttatacgtccttaattaagtattattataacggcattaccgttgatataaaactattagtatcgttgagtaatgaccctt |
23864084 |
T |
|
| Q |
106 |
gtnnnnnnntgaaacggggtcctagctaacttgtcacaatttaaattgggttctctcttttaataaagatttaggcctctttattgtttgcttgtaataa |
205 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23864085 |
gt-ggggggtgaaacggggtcctagctaacttgtcacaatttacattgggttctctcttttaataaatatttaggcctctttattgtttgcttgtaataa |
23864183 |
T |
|
| Q |
206 |
tacatctaaa |
215 |
Q |
| |
|
|||||||||| |
|
|
| T |
23864184 |
tacatctaaa |
23864193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University