View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_269 (Length: 232)
Name: NF11280A_low_269
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_269 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 70 - 232
Target Start/End: Complemental strand, 41006947 - 41006785
Alignment:
| Q |
70 |
ttatgttttaaacagtagtttctccttctgttaaagaaaatatttccagtgtctcatacacttttactaactggtagttaaattttggggggtatatgtg |
169 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41006947 |
ttatgttttaaatagtagtttctccttctgttaaagaaaatatttccagtgtctcatacacttttactaactggtagttaaattttggggggtatatgtg |
41006848 |
T |
|
| Q |
170 |
tatacttttttgatagannnnnnngagggatatgtatgcatgaatggattcccatgcttgtta |
232 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41006847 |
tatacttttttgatagatttttttgagggatatgtatgaatgaatggattcccatgcttgtta |
41006785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 14 - 65
Target Start/End: Complemental strand, 41007021 - 41006970
Alignment:
| Q |
14 |
aaagggtgcaaataatcaaaatgctatttcaaaagtaattttagctaacgta |
65 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41007021 |
aaagggtgcagataatcaaaatgctatttcagaagtaattttagctaacgta |
41006970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University